Home ••• Newswires by Industry • Countries • U.S. States • World Media Directory

Healthcare Industry News ••• Topics • Countries • U.S. States

Brain Plasticity News Monitoring

Get by Email • RSS

Published on Dec 3, 2024

Cannabis Impacts Brain Plasticity via Astrocyte Receptors

Summary: Researchers discovered that cannabis affects brain development by interacting with CB1 receptors on astrocytes, not just neurons. Using a mouse model, they showed that removing these receptors impaired the brain’s ability to adapt during critical …

Source: Neuroscience News - Texas - Label Pending
Published on Dec 3, 2024

Covid lockdowns linked to faster brain ageing in teens, girls most affected

A recent study found that COVID-19 lockdowns caused noticeable changes in teenagers’ brains. Researchers at the University of Washington in Seattle used MRI scans to observe that the usual thinning of the brain’s cortex, which happens with age, sped up …

Source: India Today - Neutral
Published on Dec 2, 2024

COVID lockdowns affected adolescents’ brain structures, says research

A recent study reported the somewhat alarming observation that the social disruptions of COVID lockdowns caused significant changes in teenagers’ brains. Using MRI data, researchers at the University of Washington in Seattle showed that the usual, age- …

Source: The Conversation - Neutral
Published on Dec 3, 2024

World News | COVID Lockdowns Affected Adolescents' Brain Structures, Says Research

Loughborough (UK), Dec 3 (The Conversation) A recent study reported the somewhat alarming observation that the social disruptions of COVID lockdowns caused significant changes in teenagers' brains. Using MRI data, researchers at the University of …

Source: Latestly - Uncategorized
Published on Dec 4, 2024

Professor Peter Falkai suggests promising new directions in schizophrenia treatment

In a comprehensive Genomic Press Interview, distinguished psychiatrist Professor Peter Falkai suggests promising new directions in schizophrenia treatment through his groundbreaking research on brain plasticity and myelin regeneration. As the newly …

Source: Medical News - Neutral
Published on Dec 2, 2024

Why These Millennia-Old Brains Are So Well Preserved

No part of our body is as perishable as the brain. Within minutes of losing its supply of blood and oxygen, our delicate neurological machinery begins to suffer irreversible damage. The brain is our most energy-greedy organ, and in the hours after death, …

Source: Scientific American - Neutral
Published on Dec 4, 2024

Gate Neurosciences and Pitt commence antidepressant drug trial

Gate Neurosciences and the University of Pittsburgh (Pitt) have commenced a Phase II clinical trial to evaluate the potential of extending the efficacy of the rapid-acting antidepressant drug apimostinel, when used alongside the university’s digital …

Source: Clinical Trials Arena - Label Pending
Published on Nov 29, 2024

We’re finally starting to understand the pregnant brain

"Pregnancy brain” is often treated as a punchline, but a new study shows it’s a stunning metamorphosis that scientists are just beginning to grasp — potentially unlocking new knowledge about pregnancy complications and the amazing plasticity of our …

Source: Japan Times - Neutral
Published on Dec 1, 2024

The exhaustion of getting old — next year, I’m embracing the reverse bucket list with vigour

This is my last column before Christmas. Inconceivable! I woke up one morning this week resolved to apply for a writing course beginning in February. That is, February 2024. That it is the end of November fills me with astonishment and distress. Where has …

Source: Daily Maverick - Neutral
Published on Nov 28, 2024

10 Benefits of Running a Mile a Day

By Ali Al-Sardar Running is a simple yet powerful exercise that requires minimal equipment and can be done almost anywhere. Among the various running routines, running a mile a day stands out for its numerous health benefits. This habit can significantly …

Source: The Good Men Project - California - Left-wing
Published on Dec 4, 2024

Unlocking the science of sleep: how rest enhances language learning

UniSA researchers have identified the importance of sleep in learning a new language.Sleep is critical for all sorts of reasons, but a team of international scientists has discovered a new incentive for getting eight hours of sleep every night: it helps …

Source: The National Tribune - Center-left
Published on Dec 4, 2024

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

Around one in 100 people live with an autism spectrum disorder, a developmental brain disorder characterized by difficulties in social interaction and unusual behavior patterns, such as an acute attention to detail. In only one in five cases is a …

Source: El País - Center-left
Published on Dec 4, 2024

Introducing Moodeys: The organic functional mushroom brand with 5x the strength of competitors

Moodeys, a leading wellness company, utilises the benefits of functional mushrooms to improve mood, anxiety, sleep, and productivity. The clinically proven ingredients are 100% organic and natural, with no fillers to ensure the best quality. Expertly …

Source: Wellbeing Magazine - Neutral
Published on Dec 4, 2024

Scientists identify molecular mechanism behind idiopathic autism

Autism is a neurodevelopmental disorder characterized by difficulties in communication and social behavior. Approximately 20% of cases are linked to a specific genetic mutation, but the origin of the remaining 80%, known as idiopathic autism, remains a …

Source: Medical News - Neutral
Published on Dec 3, 2024

Learning enhances behaviorally relevant representations in apical dendrites

Learning and memory depend on the ability of biological networks to alter their activity based on past experience. For example, as animals learn the behavioral relevance of stimuli in a sensory discrimination task, neural representations of those stimuli …

Source: eLife - Label Pending
Published on Dec 3, 2024

A neural correlate of individual odor preference in Drosophila

Individuality is a fundamental aspect of behavior that is observed even among genetically-identical animals reared in similar environments. We are specifically interested in individuality that is evident as idiosyncratic differences in behavior that …

Source: eLife - Label Pending
Published on Dec 3, 2024

Our Goal is to Reverse Paralysis — if Washington Doesn’t Get In the Way

Imagine being told you’ll never walk again due to a brain or spinal cord injury. Now imagine a treatment that could reverse your paralysis. This isn’t science fiction — it’s cutting-edge neuroscience research happening in labs right now. Scientists at Yale …

Source: Cascade Business News - Oregon - Neutral
Published on Dec 3, 2024

Peabody Exhibition Plays With Perception

"Mind/Matter" show panel: Something's not quite right here ... Look once, and it’s just an upside-down face of a woman smiling. But look again, perhaps a third time, and a few details seem off. Something’s wrong, definitely wrong, even if …

Source: New Haven Independent - Connecticut - Center-left
Published on Dec 3, 2024

Transcription Factors ASCL1 and OLIG2 Drive Glioblastoma Initiation and Co-Regulate Tumor Cell Types and Migration

Glioblastomas (GBMs) are highly aggressive, infiltrative, and heterogeneous brain tumors driven by complex genetic alterations. The basic-helix-loop-helix (bHLH) transcription factors ASCL1 and OLIG2 are dynamically co-expressed in GBMs; however, their …

Source: Newswise - Neutral

28 days 09:09:22

Featured Releases

Got News to Share? · Submit · See All

Published on December 4, 2024 - 08:48 GMT

Rising Trends of Elective Healthcare Services Market will Witness Substantial Growth With indetailed Competitor Analysis

Rising Trends of Elective Healthcare Services Market will Witness Substantial Growth With in-detailed Competitor Analysis Forecast to 2024-2032 224 W 35TH ST STE 500, NY, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- The Elective …

Distribution channels: Healthcare & Pharmaceuticals Industry ...
Published on December 4, 2024 - 21:05 GMT

Option Care Health to Participate in the J.P. Morgan Healthcare Conference

BANNOCKBURN, Ill., Dec. 04, 2024 (GLOBE NEWSWIRE) -- Option Care Health, Inc. (“Option Care Health”) (Nasdaq: OPCH), the nation’s largest independent provider of home and alternate site infusion services, will participate in the 43rd Annual J.P. Morgan …

Distribution channels: Culture, Society & Lifestyle, Healthcare & Pharmaceuticals Industry ...

Published on December 4, 2024 - 20:00 GMT

Questex’s Fierce Healthcare Announces 2024 Innovation Awards Winners

NEW YORK, Dec. 04, 2024 (GLOBE NEWSWIRE) -- Questex’s Fierce Healthcare today announces the winners of the Fierce Healthcare Innovation Awards. The program showcases outstanding innovation that is driving improvements and transforming the industry. “The …

Distribution channels:
Published on December 4, 2024 - 16:23 GMT

Corza Medical auf Platz 14 der Top 100 Healthcare Technology Companies of 2024

WESTWOOD, Mass., Dec. 04, 2024 (GLOBE NEWSWIRE) -- Corza Medical („Corza“ oder das „Unternehmen“), ein weltweit führendes Medizintechnikunternehmen, das sich für bemerkenswerten Service, zuverlässige Leistung und herausragenden Wert einsetzt, wurde …

Distribution channels:

Published on December 4, 2024 - 16:00 GMT

BRODSKY & SMITH SHAREHOLDER UPDATE: Notifying Investors of the Following Investigations: Cross Country Healthcare, Inc. (...

BALA CYNWYD, Pa., Dec. 04, 2024 (GLOBE NEWSWIRE) -- Brodsky & Smith reminds investors of the following investigations. If you own shares and wish to discuss the investigation, contact Jason Brodsky (jbrodsky@brodskysmith.com) or Marc Ackerman ( …

Distribution channels:
Published on December 4, 2024 - 15:30 GMT

Generic Pharmaceuticals Market to Hit $947.67 Bn by 2034, says Healthcare Expert

Ottawa, Dec. 04, 2024 (GLOBE NEWSWIRE) -- The global generic pharmaceuticals market size was valued at USD 424.98 billion in 2024 and is predicted to hit around USD 874.63 billion by 2033, a study published by Towards Healthcare a sister firm of Precedence …

Distribution channels:
Published on December 4, 2024 - 14:00 GMT

Konica Minolta Healthcare and Gleamer Partner to Provide Best-in-Class AI-Powered Solution with Konica Minolta's ...

WAYNE, N.J., Dec. 04, 2024 (GLOBE NEWSWIRE) -- Konica Minolta Healthcare Americas, Inc., a leading provider of medical diagnostic imaging and imaging information technology, and Gleamer, a leading European developer of artificial intelligence (AI) powered …

Distribution channels:
Published on December 4, 2024 - 13:30 GMT

Pompano Veterinary Oncology Partners with Sensus Healthcare to Provide First Superficial Radiotherapy Services in a ...

Full-service medical oncology practice to pioneer the use of SRT to treat companion animals for both home and veterinary clinic visits BOCA RATON, Fla, Dec. 04, 2024 (GLOBE NEWSWIRE) -- Sensus Healthcare, Inc. (Nasdaq: SRTS), a medical device company …

Distribution channels:

Got news to share? Submit it now.

Load more healthcare industry news or search news using your own keywords. There are 766,304,491 articles in our news database.

Online News Monitoring Made Simple

Established in 1995, EIN Newsdesk helps millions of users track breaking news across thousands of trusted websites. Users may set up custom email newsletters and RSS feeds or search among thousands of preset news sections. As a member, you may also submit your own news using the EIN Presswire distribution service. Membership is free and we do not sell or lease any information about you. Press release distribution, dedicated APIs, and custom services generate the revenue that allow us to offer you free basic access.

News by Country & by Industry

Worldwide News Coverage

Track news across more than 5,000 sources by country or industry or search our real-time news index.

Healthcare Industry News by Country

Healthcare Industry News by U.S. State

Healthcare Industry News Topics

Online News Publications

World News Report

News Alerts & News Feeds

Custom News Monitoring

News page results can be outputted as RSS or received daily by email. You may also use our NewsPlugin for WordPress.

Create Email Newsletter

Create RSS Feed

NewsPlugin for WordPress

Submit News

PR Distribution Service

Our EIN Presswire's distribution footprint reaches millions. You can upload news which is re-published through EIN Newsdesk, fed into Twitter and Facebook, and onto partner sites, Google News, Bing News, etc.

EIN Presswire

Events

World Media Directory

News Media Guide

This is a listing of the world’s TV stations, radio stations, newspapers, and blogs. Last update: 11/19/2024

World Media Directory

Healthcare & Pharmaceuticals Industry Press Releases

Got News to Share? · Submit · See All

Published on December 5, 2024 - 00:29 GMT

Workers Benefit Fund Announces Acquisition of Upward Finance

WBF acquires Upward Finance, expanding its mission to support gig workers by integrating healthcare with innovative financial tools and benefits. NY, NY, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- The Workers Benefit Fund (WBF), a …

Distribution channels: Business & Economy, Companies ...
Published on December 5, 2024 - 00:14 GMT

TRUSTED DERMATOLOGIST OFFERS CUTTING-EDGE TREATMENT FOR CHRONIC SKIN CONDITION, VITILIGO

Dr. Anna Chacon and her Nationwide Teledermatology Practice Offer Sought After Depigmentation Treatment for Advanced Vitiligo Using Monobenzone MIAMI, FL, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- Dr. Anna Chacon; groundbreaking …

Distribution channels: Beauty & Hair Care, Healthcare & Pharmaceuticals Industry ...
Published on December 4, 2024 - 23:59 GMT

Unique Arizona Heroes Memorial Now Officially Open

TUCSON, AZ, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- A one-of-kind memorial is now open in Arizona as hundreds gathered to honor and celebrate the heroes who sacrifice to keep us safe, healthy, and free. The Arizona Heroes …

Distribution channels: Business & Economy, Emergency Services ...
Published on December 4, 2024 - 23:30 GMT

Acute Intermittent Porphyria Global Market Report 2024: Market Size To Reach $5.6 Billion By 2028

The Business Research Company’s Early Year-End Sale! Get up to 30% off detailed market research reports—for a limited time only! LONDON, GREATER LONDON, UNITED KINGDOM, December 5, 2024 /⁨EINPresswire.com⁩/ -- The Business Research Company’s Early …

Distribution channels: Business & Economy, Companies ...
Published on December 4, 2024 - 23:30 GMT

Acute Ischemic Stroke Therapeutics Global Market Report 2024: Exploring Growth, Trends, and Projections

The Business Research Company’s Early Year-End Sale! Get up to 30% off detailed market research reports—for a limited time only! LONDON, GREATER LONDON, UNITED KINGDOM, December 5, 2024 /⁨EINPresswire.com⁩/ -- The Business Research Company’s …

Distribution channels: Business & Economy, Companies ...
Published on December 4, 2024 - 23:30 GMT

Addiction Rehab Facilities Global Market Report 2024: Market Size To Reach $27.6 Billion By 2028

The Business Research Company’s Early Year-End Sale! Get up to 30% off detailed market research reports—for a limited time only! LONDON, GREATER LONDON, UNITED KINGDOM, December 5, 2024 /⁨EINPresswire.com⁩/ -- The Business Research Company’s Early …

Distribution channels: Business & Economy, Companies ...
Published on December 4, 2024 - 23:30 GMT

Global Adult Stem Cell Assay Market Forecast: Key Growth Drivers, Trends, and Opportunities from 2024 to 2033

The Business Research Company’s Early Year-End Sale! Get up to 30% off detailed market research reports—for a limited time only! LONDON, GREATER LONDON, UNITED KINGDOM, December 5, 2024 /⁨EINPresswire.com⁩/ -- The Business Research Company’s Early …

Distribution channels: Business & Economy, Companies ...
Published on December 4, 2024 - 23:30 GMT

Unprecedented Scope for Growth in Advanced Life Support ALS Training Manikins Market

The Business Research Company’s Early Year-End Sale! Get up to 30% off detailed market research reports—for a limited time only! LONDON, GREATER LONDON, UNITED KINGDOM, December 5, 2024 /⁨EINPresswire.com⁩/ -- The Business Research Company’s Early …

Distribution channels: Business & Economy, Companies ...
Published on December 4, 2024 - 23:08 GMT

Endonovo Restructures Business as Developers of Integrated AI Digital Health and Wellness Platform

Endonovo Restructures Business as Developers of Integrated AI Digital Health and Wellness Platform LOS ANGELES, CA, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- Endonovo Restructures Business as Developers of Integrated AI Digital …

Distribution channels: Healthcare & Pharmaceuticals Industry ...
Published on December 4, 2024 - 22:50 GMT

Grey Lynn Invisalign for Teeth Straightening: Adult Orthodontic Treatment Update

Grey Lynn, Auckland - All Smiles Dental - 0800 255 764 - has updated its orthodontic treatments MT EDEN, AUCKLAND, NEW ZEALAND, December 5, 2024 /⁨EINPresswire.com⁩/ -- All Smiles Dental now offers Invisalign to Grey Lynn, a discreet, removable …

Distribution channels: Beauty & Hair Care, Healthcare & Pharmaceuticals Industry ...
Published on December 4, 2024 - 22:02 GMT

Nikon and eLabNext collaborate to integrate the NIS-Elements imaging platform with eLabNext’s Digital Lab Platform

Nikon and eLabNext partner to enhance data integration between NIS- Elements imaging software and eLabNext’s Digital Lab Platform. BOSTON, MA, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- The NIS-Elements eLabNext module allows users to …

Distribution channels: Education, Electronics Industry ...
Published on December 4, 2024 - 21:26 GMT

Davis Street Community Center is Collecting New Unwrapped Toys and Donations to support families in need this season

Davis Street Community Center Seeks Community Support for Holiday Basket Program, Aiming to Provide 1,200 Families and Seniors with Festive Meals and Gifts SAN LEANDRO, CA, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- Davis Street …

Distribution channels: Education, Emergency Services ...
Published on December 4, 2024 - 21:09 GMT

HonorHealth is first non-clinical trial site in Arizona to perform minimally invasive tricuspid valve replacement

This advanced technique utilizes a catheter to implant an artificial, self-expanding tricuspid valve to prevent or reduce tricuspid regurgitation. SCOTTSDALE, ARIZONA, AZ, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- HonorHealth, a …

Distribution channels: Healthcare & Pharmaceuticals Industry, Media, Advertising & PR ...
Published on December 4, 2024 - 21:07 GMT

Antivenom Market Projected to Reach $691.0 Million by 2033 at a CAGR of 6.7%

The antivenom market is poised for significant growth, with forecasts indicating a surge from $359.9 million in 2023 to an estimated $691.0 million by 2033. WILMINGTON, DE, UNITED STATES, December 5, 2024 /⁨EINPresswire.com⁩/ -- The antivenom …

Distribution channels: Business & Economy, Healthcare & Pharmaceuticals Industry ...
Published on December 4, 2024 - 21:07 GMT

Urokinase Market to Reach $3.1 Billion by 2033 with 5.7% CAGR Growth

The global urokinase market, valued at $1.8 billion in 2023, is expected to reach $3.1 billion by 2033, expanding at a CAGR of 5.7%. WILMINGTON, DE, UNITED STATES, December 5, 2024 /⁨EINPresswire.com⁩/ -- The urokinase market is projected to …

Distribution channels: Business & Economy, Healthcare & Pharmaceuticals Industry ...
Published on December 4, 2024 - 20:52 GMT

Dallas Rhinoplasty Surgeon, Dr. Rod J. Rohrich, to Host the 42nd Annual Global Dallas Rhinoplasty Meeting

Dr. Rod J. Rohrich, Dallas plastic surgeon and Chairman will host Dallas Rhinoplasty Meeting, to be held from February 28th to March 2nd, 2025. DALLAS, TX, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- Dallas rhinoplasty surgeon, Dr. Rod …

Distribution channels: Beauty & Hair Care, Conferences & Trade Fairs ...
Published on December 4, 2024 - 20:37 GMT

Strolll and Lovell Announce Partnership to Increase Access to Augmented Reality to Neuro Rehabilitation for VA, DoD

Partnership Aims on Improving Therapy Outcomes for Veterans and Service Members with Innovative AR Solutions PENSACOLA , FL, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- XX/XX/XX Pensacola, FL – Lovell® Government Services and …

Distribution channels: Electronics Industry, Healthcare & Pharmaceuticals Industry ...
Published on December 4, 2024 - 20:30 GMT

Arcus Power Launches Power Market Data Solutions on Snowflake Marketplace

Customers can now access Arcus Power’s comprehensive power market data for advanced analytics and informed decision-making CALGARY, ALBERTA, CANADA, December 4, 2024 /⁨EINPresswire.com⁩/ -- Arcus Power today announced the launch of its Power …

Distribution channels: Agriculture, Farming & Forestry Industry, Automotive Industry ...
Published on December 4, 2024 - 20:09 GMT

SOBA New Jersey: Helping Families Heal from Addiction

SOBA New Jersey Expands Support for Families Battling Addiction NEW BRUNSWICK, NJ, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- Addiction affects more than the individual—it impacts families, communities, and relationships. SOBA New …

Distribution channels: Companies, Culture, Society & Lifestyle ...
Published on December 4, 2024 - 19:59 GMT

EncompaaS Wins Fierce Life Sciences Innovation Award for AI-Powered Rebate Management Solution

EncompaaS’ solution recognized for bringing actionable information directly to users by inspecting complex rebate contracts and efficiently extracting data VALENCIA, CA, UNITED STATES, December 4, 2024 /⁨EINPresswire.com⁩/ -- EncompaaS, a global …

Distribution channels: Business & Economy, Companies ...